Even though the promoters are related, T7, T3 and SP6 polymerases are exquisitely specific for their own promoter sequence. The consensus promoters of T7, T3 and SP6 promoters are shown below.(1) The minimal promoter sequence required for efficient transcription is shown in italics. Transcription initiates at position +1 (underlined). Nucleotides upstream of the first initiating nucleotide are numbered -17 to -1. When making short transcripts, synthetic oligonucleotides are often used as templates. Only nucleotides -17 to -1 must be double stranded. The bottom strand of the transcription template can be single stranded. The identity of the first few transcribed bases can significantly influence transcription yields. For optimal performance, T7 and T3 transcripts should initiate with GGG, and SP6 transcripts should initiate with GAA. When transcripts are made with modified nucleotides, it is desirable to avoid these bases in the first 10 nucleotides, if possible, to minimize abortive transcription products.
T7 Promoter
5′ TAATACGACTCACTATAGGGAGA 3′
T3 Promoter
5′ AATTAACCCTCACTAAAGGGAGA 3′
SP6 Promoter
5′ ATTTAGGTGACACTATAGAAG 3′ |
The minimal requirements for a transcription reaction are a DNA template containing a bacteriophage promoter, a bacteriophage polymerase, ribonucleoside triphosphates and a buffer containing magnesium. The DNA template can be two synthetic oligonucleotides annealed to each other, a PCR product or a linearized plasmid.
Run-off Transcription
In bacteria, transcription terminates at transcriptional termination sequences. For In vitro work most researches use "run-off" transcription, where the template is linear and the polymerase terminates transcription when it reaches the 3′ end. In some cases the polymerase can reach the end and begin transcription of the opposite strand. For double stranded templates that are produced by restriction digestion, this is minimized by using restriction enzymes that leave a blunt end or a 5′ overhang. On circular templates, bacteriophage polymerases can quite efficiently generate very long contaminating transcripts by rolling circle transcription. When using a plasmid as a PCR template to produce a transcription template, it is recommended that the plasmid first be linearized using a restriction enzyme that cuts outside the transcription cassette. This step minimizes the contaminating transcripts.
|
