- IVT N1mΨ-mRNA is Rooted in a PhD Study Published by Andries et al. in 2015 at Ghent University
- The Publication Has Already Received More Than 130 Citations
- Both the Pfizer-BioNTech and Moderna Vaccines Against COVID-19 Utilize IVT N1mΨ-mRNA Technology
There is widespread interest in chemically modified mRNA (modRNA) synthesized by in vitro transcription (IVT) reactions, wherein one or more of the natural (aka wild-type) A, G, C, and U nucleotide 5’-triphosphates is replaced by base-modified analogs. The evolution of this interest in modRNA can be traced back to a 2005 report by Karikó et al. demonstrating that modRNAs comprised of 5-methycytidine (5mC), N6-methyladenosine (m6A), pseudouridine (Ψ), 5-methyluridine (m5U), and 2-thiouridine (s2U) either separately or in combination can reduce immunogenicity mediated by toll-like receptors (TLRs).
Subsequently, it was shown that Ψ modification, in particular, could increase the translational capacity and biological stability of mRNA (Karikó et al. 2008). Along the lines of the familiar saying “good, better, best...,” latter studies by others (Andries et al. 2015) found that simply adding a methyl group to the N1 position in Ψ (N1-methylpseudouridine, N1mΨ) in modRNA via IVT with the corresponding 5’-triphosphate (shown here) produced N1mΨ-mRNA that outperformed Ψ-mRNA.
Perhaps the most compelling evidence of the performance enhancement provided by N1mΨ-mRNA is the COVID-19 mRNA vaccines developed independently by Pfizer-BioNTech and Moderna, both of which are comprised of mRNA with complete replacement of uridine by N1mΨ. In view of this unarguably proven utility of N1mΨ-mRNA, the Zone is featuring N1mΨ-mRNA in two blogs. This blog post is Part 1 and provides some backstory on the initial discovery of the benefits of N1mΨ-mRNA, as well as a subsequent investigation into optimizing the performance of IVT mRNA using N1mΨ. Part 2 will follow soon and feature the use of N1mΨ to optimize mRNA for heart gene therapy.
Backstory
Following the development of the modRNA platform, various pre-clinical studies demonstrated its potential for therapeutic applications. These notably included Warren et al., which used 5mC/Ψ-mRNA to reprogram and differentiate human cells, and the work of Zangi et al., which used 5mC/Ψ-mRNA to treat a mouse model of myocardial infarction.
Based on these promising in vitro and in vivo findings, and as part of her PhD thesis at Ghent University in Belgium, Oliwia Andries (pictured here) states that she “sought to identify RNA base modifications that could further reduce the immunogenicity and translational capacity of mRNA by using mRNA containing Ψ as a benchmark.” The findings of that search, which was conducted in collaboration with others, were reported in 2015 (Andries et al.) titled, N1mΨ-incorporated mRNA outperforms Ψ-incorporated mRNA by providing enhanced protein expression and reduced immunogenicity in mammalian cell lines and mice.
Briefly, it was demonstrated that N1mΨ, long known in the biosynthesis of hypermodified 18S rRNA of yeast (Brand et al. 1978), markedly improved the translational capacity of mRNA compared with Ψ-mRNA and 5mC/Ψ-mRNA in A549 cells (human lung epithelial cells), BJ cells (human foreskin fibroblasts), C2C12 cells (murine myoblasts), HeLa cells (human cervix epithelial cells), human primary keratinocytes from neonatal foreskin, and in mice after intradermal (i.d.) or intramuscular (i.m.) injection of modRNAs. It did so when incorporated alone or in combination with 5mC (5mC/ N1mΨ). 5mC/ N1mΨ-mRNA was also shown to have reduced toxicity and reduced activation of the intracellular innate immune response in the various cell lines compared with 5mC/Ψ-mRNA. Finally, the superiority of 5mC/ N1mΨ-mRNA over 5mC/Ψ-mRNA was shown to be at least partially due to its enhanced ability to avoid activation of TLR3, shown here bound to double-stranded RNA.
Although Andries et al. concluded that 5mC/ N1mΨ-mRNA might be a new benchmark for modRNA-based therapeutic applications, later studies (discussed below) found more complex relationships between 5mC/ N1mΨ-mRNA composition and its biological effects.
Finally, the Zone is pleased to add that all of the required base-modified 5’-triphosphates used for IVT of the modRNAs described in these seminal studies by Andries et al. were obtained from TriLink. In addition, the Zone used Google Scholar to sort 134 citations of Andries et al. by year following the study’s publication in November 2015, as well as to estimate the number of citations in 2021 (n = 44) by extrapolation of the number (11) for January to March of 2021. Interestingly, all of these data points closely fit the calculated linear-trend dashed line, which implies continued interest in N1mΨ-mRNA.
Optimizing the Functionality of IVT mRNA
This section heading is from the title of a 2018 publication (Tusup et al.) by a collaborative team in Zurich, Switzerland, led by Prof. Steve Pascolo (pictured here), one of the pioneers of IVT mRNA as a new paradigm for vaccines.
By way of an introduction to this work, which cites Andries et al., Tusup et al. note that previously published studies used IVT mRNA that was either co-transcriptionally capped with the ARCA analogue or post-transcriptionally capped using vaccinia capping enzymes. In the present work, they chose to use mRNA co-transcriptionally capped with a “superlative Cap 1 analogue: a dinucleotide called CleanCap®AG that has the formula m7G(5’)ppp(5’)(2’OMeA)pG (TriLink).”
Concerning the 5’ UTR, the researchers previously found that a sequence corresponding to an aptamer targeting the eukaryotic translation initiation factor 4 G (eIF4G)—a protein involved in translation initiation as a component of the eIF4F cap-binding complex—was capable of enhancing translation of IVT mRNA. Therefore, as outlined in the following sections, Tusup et al. investigated the 3’ UTR and the impact of unmodified versus modified bases on the functionality of CleanCap® IVT mRNA.
Effect of the 3’ UTR on Expression of IVT mRNA
Using an IVT reaction containing ATP, GTP, 5mC, and N1mΨ 5’-triphosphate (all from TriLink), luciferase-coding mRNAs were generated to include a 5’ CleanCap® structure, an eIF4G aptamer sequence (see aptamer 17 in Miyakawa et al. 2006), and a codon-optimized coding sequence terminated at the 3’ end with either 1) a stop codon, TAA, immediately followed by a poly(A) sequence (termed “StoPolyA”), 2) a stop codon followed by the minimal sequence 5’ GAGAGCTCGCTTTCTTGCTG 3’and a poly(A) tail (termed “Minimal 3’ UTR”), or 3) a stop codon followed by a tandem repeat of the beta-globin 3’ UTR and a poly(A) tail (termed “bgbg”). These three mRNAs were transfected into cells, and the luciferase activity (depicted here) was recorded one day later.
All three types of IVT mRNAs could be translated into cells. In tumor cells, such as human embryonic kidney (HEK) cells and undifferentiated mouse colon carcinoma (CT26 cells) cells, the presence of a sequence between the stop codon and the poly(A) tail, whether a short or double repeat of beta-globin UTR, performed best. However, in immune cells such as human peripheral blood mononuclear cells (PBMCs) or mouse splenocytes, the mRNA constructs with a double beta-globin 3’ UTR allowed for a higher luciferase expression. The advantage provided by the “bgbg” 3’ UTR was even more apparent in vivo in mice that were intravenously administered with mRNA formulations, which allowed for expression primarily in the liver and lymphoid organs 5 hours after injection, as shown here in Figure 1.
Effect of Modified Nucleotides on the Expression of IVT mRNAs
Using a PCR matrix with a 5’ eIF4G aptamer sequence, a codon-optimized coding sequence, and a tandem repeat of the beta-globin 3’ UTR, Tusup et al. generated IVT mRNAs containing either A, C, G, and U residues (termed “ACGU”), A, C, G, and N1mΨ residues (termed “ACGPseudo”), or A, 5mC, G, and N1mΨ residues (termed “A5mCGPseudo”). All of these RNAs had a 5’ CleanCap® structure and were polyadenylated using a poly(A) polymerase. They were then transfected into the cells mentioned above, and luciferase activity was recorded one day later. The ACGU mRNA performed best in tumor cells, whereas the ACGPseudo mRNA performed best in immune cells. Using real-time fluorescence measurements, ACGU and ACGPseudo mRNAs showed similar functions after 5 hours, as shown in Figure 2.
According to Tusup et al., the in vitro cellular transfection result patterns reveal that a) the functionality of CleanCap® IVT mRNA might be reduced by the introduction of N1mΨ and 5mC (differing from previous reports that indicate that these substitutions in post-transcriptionally capped IVT mRNA enhance functionality in tumor cell lines), and b) the triggering of immune receptors in immune cells by unmodified IVT RNA induces a state of reduced translation (the “interferon” effect) that abrogates expression from the transfected IVT mRNA more strongly than modified nucleotides do.
This effect was seen in vivo at the peak of expression (~5 hours). After injection of mRNA formulated to be delivered primarily to the liver, the “ACGU” IVT mRNA was not expressed in the liver but was slightly expressed in the spleen, probably by immune cells such as CD169+ macrophages resistant to the interferon effect. On the other hand, “ACGPseudo” and “A5mCGPseudo” IVT mRNAs were expressed primarily in the liver, with the former expressed at approximately four-fold higher levels than the latter (Figure 2). Imaging at 24 hours post-injection did not allow detection of any signal (data not shown).
Effect of Modified Nucleotides on Immunostimulation by IVT mRNAs
Tusup and Pascolo used a strong immunostimulating protamine-RNA formulation to investigate the ability of “ACGU,” “ACGPseudo,” and “A5mCGPseudo” IVT mRNAs to trigger innate immunity. While “ACGU” IVT mRNA induced a strong production of both interferon-α and TNF-α, neither the “ACGPseudo” nor the “A5mCGPseudo” IVT mRNAs triggered immunity (no significant differences between “No mRNA” or “Protamine” when compared with “ACGPseudo” or “A5mCGPseudo” mRNA for both interferon-α and TNF-α; data not shown). Thus, according to Tussup et al., using the production and purification methods outlined above, the substitution of only U residues by N1mΨ residues was sufficient to entirely abrogate the “danger signal” feature of IVT mRNA.
Summary Conclusions
According to Tusup et al., “superlative IVT mRNA should have, in addition to an optimized 5’ UTR (a CleanCap® structure followed by an eIF4G aptamer), a tandem repeat of the beta-globin 3’ UTR, and be composed of:
a) Adenosine, cytidine, guanosine, and uridine residues if the IVT mRNA is to be used in the absence of immune receptors (e.g., in vitro studies in tumor cell lines and production of proteins by tumor cells); or
b) Adenosine, cytidine, guanosine, and N1mΨ-residues if the IVT mRNA is to be used in the presence of immune receptors (e.g., injections in vivo).”
Tusup et al. further note that the results presented in Figure 2 differ from previously published work (Karikó et al. 2011; Svitkin et al. 2017; Andries et al. 2015), which reported that N1mΨ-containing mRNA outperforms U-containing mRNA when IVT mRNA is transfected in tumor cells. They add that differences in the composition (e.g., co-transcriptionally incorporated CleanCap® and eIF4G aptamer 5’ UTR), manufacturing (purification by LiCl precipitation), or transfection (MessengerMax in vitro and TransIT in vivo) may explain this discrepancy. Having shown that the substitution of C residues by 5mC residues reduces the functionality of IVT mRNA (Figure 2), while the substitution of U residues by N1mΨ residues is sufficient to fully abrogate the triggering of immune receptors by IVT mRNA, Tusup et al. recommend against using 5mC for the production of IVT mRNA.
Concluding Comments
Although investigations and applications of IVT synthesized modRNAs have advanced rapidly in recent years, the Zone’s view is that it is still “early days” in terms of gaining a comprehensive understanding of all the factors that influence the biological functionality of IVT modRNAs. By analogy to how the functional “rules” in the early days of antisense oligonucleotide and small-interfering RNA therapeutics changed with new data from further experimentation, the field of IVT modRNAs will also likely go through periods of changing rules based on experimental results in other biological systems and the possibility of system-by-system dependencies.
In addition to the availability of the above mentioned modified NTPs, there are now more protocols for the relatively easy and robust synthesis of IVT modRNAs with higher purity than before (see Henderson et al. Current Protocols 2021), as well as other promising candidates to test, such as 5-methoxy-UTP (see McCaffrey and collaborators 2018).
Consequently, empirical screening of various constructs in your particular biological system or model of interest seems the wisest strategy. In other words, in these early days, a data-driven strategy seems most prudent.
What do you think?
Your comments are welcomed, as usual.
Please feel free to share this blog with your colleagues or on social media.
