Spotlight on TriLink Product Applications Published in 2020

• Nobel Prize Winning CRISPR Gene-Editing Publications Dominate 
• Modified mRNA Usage and Vaccines Are Also Prevalent
• Applications of Aptamers for Cancer Therapy Are Abundant 

Introduction

Devotees of the Zone will recall that, in January of the new year, the first blog has traditionally focused on the preceding year’s most noteworthy nucleic acid publications or on the “best of” new technologies, as voted by The Scientist magazine. With the COVID-19 pandemic, 2020 has been completely unlike any other year, and to fit this theme, the Zone decided that the retrospective view of this year would also not be like its predecessors. 

This year, we chose to look back at the scientific literature published in 2020 that cited TriLink products. As you will see from the search results discussed in the next section, the most frequent TriLink-associated publication term, CRISPR, happens to coincide with the 2020 Nobel Prize in Chemistry to Emmanuelle Charpentier and Jennifer A. Doudna, awarded to them for their development of CRISPR-based genome editing. This remarkable coincidence of CRISPR publications and the Nobel Prize underlines the widespread impact of CRISPR on scientific research.

Search Results

Google Scholar is a very powerful tool in searching for all types of scientific (and other) articles. These are primarily comprised of original research reports, reviews, patents, and citations. Searching this vast amount of information for items published in 2020 using the term “TriLink” resulted in 467 items, 46 of which (~10%) were patents that were not further analyzed. 

The remaining 421 items were then sub-searched, in each instance using one additional term. After doing this for a number of the expected “hot topics,” namely vaccine, COVID-19, CRISPR, Cas9 mRNA, etc. it was evident that these topics did indeed comprise the bulk of the 2020 literature citing TriLink. More specifically, here is the list of sub-searched terms, ranked by the number of items found and the percentage of each term relative to the 421 total nonpatent items sub-searched. 

While browsing this list, one must keep some unavoidable overlap in mind, i.e. a single publication with both the terms CRISPR and Cas9 mRNA, or one with modified mRNA and pseudouridine (ψ), etc. On the other hand, it is gratifying to know that, as stated in footnote b for Percent, exclusion of all terms listed gave only 26 items, or 6% of the 421 total nonpatent articles, thus indicating that 94% of the publications in 2020 citing a TriLink product are associated with one or more of the listed terms. 

The following sections will discuss selected 2020 examples from the three most frequently found/related terms: (1) CRISPR/Cas9, (2) vaccine/COVID-19/modified mRNA, and (3) aptamer.

CRISPR/Cas9

Functional Humanization of Immunoglobulin: According to Low et al., monoclonal antibody (mAb)-based biologics are among the fastest growing and most promising treatments for a broad range of human disorders, including cancer, autoimmune diseases, inflammatory diseases, and  diabetes. A major advantage of mAb-based biologics is their persistence in circulation, as their half-life is ~21 days in human serum. This extended pharmacokinetic (PK) behavior requires the crystallizable fragment (Fc) domain, depicted here as the stem of a Y-shaped structure. For this reason, the majority of therapeutic mAbs include the human immunoglobulin G (IgG) Fc domain.

Low et al. add that the Fc receptor, called ‘Fc fragment of IgG receptor and transporter’ (FCGRT) is primarily expressed in the early endosomes of cells within the circulatory system and is engaged in fluid-phase endocytosis. IgG-Fc binds the Fc of IgG at acidic pH, rescuing it from normal lysosomal catabolism by redirecting it to the plasma membrane. Upon encountering a neutral pH, the IgG Fc is released back into the circulation. According to researchers, this mechanism greatly slows IgG destruction, extending its persistence and bioavailability.

This FCGRT salvage mechanism previously led Low et al. to construct FCGRT-humanized mouse models for preclinical evaluations of IgG-based biologics in vivo. However, they say, these initial humanized mouse models “lack an endogenous source of human IgG that typifies the human competitive condition,” for improving mouse models of IgG-based biologics. To address this need, Low et al. used CRISPR/Cas9-mediated homology-directed repair (HDR) to further engineer their previous mouse strain (Tg32), which they did by replacing the mouse hinge (disulfide bonds, see above) and Fc domain with the equivalent human components. 

Briefly, sgRNAs were microinjected with Cas9 mRNA (TriLink) and plasmid donor DNA that comprised of a 902 bp human sequence flanked by ~5kb homology arms. A total of 95 mouse embryos derived from Tg32 were microinjected (operationally analogous to the method illustrated here) and transferred into 5 females, from which a single homozygous strain was established and determined to have the desired sequences by PCR-based Sanger sequencing.

Ciliopathies and Male Infertility: In a conceptually analogous procedure, Ding et al. used microinjection of components for CRISPR/Cas9 (TriLink)-mediated homologous recombination in zygotes to identify and validate two genetic variants causing ciliopathies and male infertility. Approximately 7% of men worldwide suffer from infertility, with sperm abnormalities being the most common defect. Though genetic causes are thought to underlie a substantial fraction of idiopathic cases, the actual molecular bases are usually undetermined. These investigators identified two deleterious alleles of RABL2A, a gene essential for normal function of cilia and flagella. Derived candidate variants were assayed for protein stability in vitro, and two destabilizing variants were successfully modeled in the genome-edited mice.

Vaccine/COVID-19/Modified-mRNA

RNA Vaccines for COVID-19: Kis et al. published a detailed expert commentary on the current COVID‐19 pandemic caused by the SARS‐CoV‐2 virus titled Rapid development and deployment of high‐volume vaccines for pandemic response. They note that there are two main types of RNA vaccines: mRNA and self‐amplifying RNA (saRNA) vaccines, the latter of which replicate inside cells. This way, they say, lower amounts of RNA are required per vaccine dose, potentially providing substantial cost benefits and higher productivity in terms of doses per liter of bioreaction, compared to non‐replicating mRNA vaccines. On the other hand, they add, mRNA vaccines are clinically more developed and widely tested compared to saRNA vaccines.

In the context of their process‐cost modeling, Kis et al. add that, while the 5′ cap analog raw material is a major cost component, “[t>

he highest‐efficiency 5′ cap analogs are CleanCap® AG and CleanCap® AU (TriLink Biotechnologies, Inc.) for mRNA and saRNA vaccines, respectively.”

mRNA-Encoded ACE2 as a Decoy for Treating COVID-19: Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) enters cells using spike proteins on its envelope, depicted here, to bind to human angiotensin-converting enzyme 2 (hACE2) expressed on the surface of airway cells. The soluble form of hACE2 has been shown to bind to SARS-CoV-2 spike protein, preventing viral entry and ameliorating lung injury. Its short half-life, however, limits its therapeutic utility.

To address this limitation, Kim et al. engineered synthetic, modified mRNA encoding a soluble form of hACE2 (hsACE2) for packaging in lipid nanoparticles (LNPs) to transfect mammalian cells for enhanced production of the secreted protein. Fluc mRNA (for visualization) and hsACE2 mRNA were obtained from TriLink with the following modifications: uridine in Fluc mRNA was fully substituted with 5-methoxyuridine, and uridine and cytidine in hsACE2 mRNA were fully substituted with pseudouridine (ψ) and 5-methylcytidine, respectively.

Intravenously administered LNPs led to hepatic delivery of the mRNA and elicited secretion of hsACE2 into the blood circulation within 2 h, with peak levels at 6 h that gradually decreased over several days. Since the primary site of entry and pathogenesis of SARS-CoV-2 is the lungs, LNPs were instilled into the lungs, leading to hsACE2 levels in the bronchoalveolar lavage fluid that were detectable within 24 h and lasted for 48 h. Importantly, hsACE2 was able to strongly inhibit (>90%) SARS-CoV-2 pseudovirus infection, a model for the actual virus. 

Aptamers

Background: Aptamers are relatively short (~20–60 nucleotides) single-stranded DNA or RNA molecules that bind with high affinity and specificity to various types of targets, typically proteins and other biological macromolecules. Aptamers are frequently referred to as “synthetic antibodies,” but they are easier to obtain, less expensive to produce, and in several ways more versatile than antibodies, attributes that have led to aptamers replacing antibodies for many applications. Following the seminal development of two aptamer selection methods in 1990, there are now well over 10,000 aptamer-related articles in PubMed, ~1,400 of which were published in 2019 alone. According to a review by Zon in 2020, many aptamer-related articles discuss cancer treatment and/or detection, as the inherent specificity of aptamers make them a sine qua non for targeted cancer applications.

Aptamer-Based Cancer Immunotherapy: According to Passariello et al., cancer immunotherapy approaches based on the use of antitumor or immunomodulatory mAbs is exemplified by use of FDA-approved ipilimumab, which recognizes the cytotoxic T lymphocyte-antigen 4 (CTLA-4). CTLA-4 plays a critical role in T cell inhibition and is also exhibited on natural killer (NK) cells, where its role has not yet been fully clarified. Despite the clinical utility of ipilimumab, its use in monotherapy is not effective against weakly immunogenic tumors, thus leading to studies and trials focused on the combination of ipilimumab with other anti-tumor drugs. 

This situation, and the broad-spectrum antitumor activity of mAb inhibitors of epidermal growth factor receptor (EGFR), led Esposito et al. to select for an anti-EGFR aptamer (CL4), which they found to induce selective apoptotic cell death. Now, Passariello et al. have tested the combinatorial treatment with ipilimumab and CL4 aptamer on tumor cells and on immune cells such as NK cells, as these are often infiltrated in some solid tumors of patients responding to the immunotherapy.

CL4 Aptamer: 5′ GCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGC 3′

To provide CL4 with resistance to degradation by nucleases, TriLink incorporated 2’-fluoro (F)-modified pyrimidines, 2’-F-C and 2’-F-U, into chemically synthesized CL4 using the corresponding 2’-F-phosphoramidite reagents, which can be obtained from Glen Research for analogous aptamer syntheses in-house if desired. Chemically linking the Fc region of ipilimumab mAb with the C6-NH₂-terminated version of this partially 2’-F-modified CL4 aptamer was accomplished using SoluLINK® technology (hydrazinonicotinamide-incorporated antibody) available from Vector Laboratories.

Briefly, it was found that this novel bispecific immunoconjugate, which is comprised of an anti-CTLA-4 portion and an anti-EGFR portion, binds to the target cells, induces the activation of lymphocytes including NK cells, and inhibits the growth of tumor target cells more efficiently than the parent compounds. It does so by strongly enhancing the cytotoxic activity of both human peripheral blood mononuclear cells and NK cells against tumor cells, as illustrated here.

Aptamer-Based Targeting of Glioblastoma Stem Cells: Among brain cancers, glioblastoma (GBM) has the worst prognosis, with a median survival of 15 months. The disease relapse rate is very high. The disease often evolves very rapidly and patients succumb in a few months. This relapse, according to Affinito et al., involves GBM stem cells (GSCs), which are a heterogeneous subpopulation of cells characterized by increased resistance to conventional GBM therapies.

Using differential cell SELEX (systematic evolution of ligands by exponential enrichment), the researchers previously prepared two RNA aptamers: 40L (long) and its truncated form A40s (short). These were modified with 2’-F-C and 2’-F-U, and they bound to the surface of GSCs derived from patients. Both aptamers were selective for stem-like growing GBM cells and were rapidly internalized into target cells. Now, Affinito et al. demonstrate that binding of these aptamers is mediated by direct recognition of the ephrin type-A receptor 2 (EphA2), a protein-tyrosine kinase implicated in mediating developmental events in the nervous system.

To identify the protein targets to which these aptamers bind, GSCs were lysed and incubated with a biotinylated sequence-scrambled oligonucleotide (TriLink) as a counterselection step before being incubated with streptavidin-coated magnetic beads. Unbound proteins were incubated with biotinylated A40s (TriLink), and the isolated bound proteins were identified by immunoblotting with EphA2 antibody.

Functionally, the two aptamers were able to inhibit cell growth, “stemness,” and migration of GSCs. Importantly, A40s was able to cross the blood-brain barrier (BBB) and was stable in serum in in vitro experiments. These results suggest that 40L and A40s represent innovative potential therapeutic tools for GBM.

Concluding Comments

The above-mentioned Google Scholar search for research articles citing TriLink in 2020 yielded 421 results, while the same search for 2015 gave 303 results, indicating an increase of ~40% over a 5-year period. Going forward with the same trend, there will be close to 600 of these publications in 2025. While it is not possible to reliably predict the relative distribution of the applications of these TriLink products, the Zone’s “crystal ball” foresees that interest in all manners of CRISPR-based gene editing will be a major component, as will applications of modified mRNA for therapeutics and, of course, vaccines.

What do you think? 

As usual, your comments are welcomed.