They all contain an optimal 5′ Cap 1 found in higher eukaryotes for their functionality and stability. They also contain a synthetic 5′ UTR with a strong Kozak sequence for efficient translation and a 3′ UTR derived from mouse alpha-globin. Their key differences lie in the type of CleanCap® analog used and the sequence compositions, which may affect their protein expression and immunogenicity.

It is TriLink’s proprietary in vitro transcription method that produces high-quality, high-yield mRNAs from a broad range of sequences. It has been optimized to minimize dsRNA and improve in vivo protein expression from the resulting mRNAs. Please see here for more information.

Our catalog mRNAs are intended for research use and manufactured with procedures in place to minimize endotoxin exposure. However, they are manufactured outside of a cleanroom and thus are not released with an endotoxin specification.  If you need mRNA released with an endotoxin specification or a higher grade of material, please contact [email protected].

We recommend storing the mRNAs at -40⁰ C to -80⁰ C. To minimize freeze-thaw cycles, aliquot the sample into single-use quantities on the first usage. If kept under these conditions, our catalog mRNAs have been shown to maintain stability for at least 2 years.

The sequence reported is just the ORF, start codon to stop codon, for our catalog mRNAs. It does not include the proprietary 5′ UTR, 3′ UTR, or the 120-nt poly-A tail. For full mRNA length and the length of the ORF please see the corresponding product insert.

Our catalog mRNAs are purified through DNase treatment to remove DNA templates, diafiltration to remove salts and small molecules, and oligo dT capture to remove impurities and retain species with poly(A) tails. 

We do not carry Cy5-labeled mRNAs as catalog products. You may order them as a custom mRNA by completing this request form.

Our CleanCap^® Cas9 mRNA, CleanCap^® Cas9 mRNAs (5moU), and CleanCap^® Cas9 mRNA (N1MePsU) contain an HA tag, 5′ TACCCCTACGACGTGCCCGACTACGCC 3′. 

We use the dot blot test, which is a qualitative test to determine the relative amount of dsRNA present in a sample. Generally, this test is performed to assess dsRNA levels in mRNAs before and after RP-HPLC purification.

We minimize the dsRNA level in our ready-to-use mRNAs by incorporating stringent processes that consist of:

• In vitro transcription using our proprietary CleanScript™ method or the CleanCap® M6 protocol
• Multiple post-IVT purification steps

We also assess dsRNA level in the sample by dot blot as part of quality analysis.

We look for a single main band running to approximately the correct length to pass the gel result.  Some factors such as modified NTPs can make a sample run slightly lower than the expected size.  Sometimes, sequence-related factors such as highly repetitive or UTP-rich regions (especially when modified UTP is used) can result in additional bands.  We take account of all these factors to confirm that the mRNA was manufactured appropriately and the band is sequence specific before passing the results.

The fragment analyzer reports the percent of smear with a chromatogram. The smear analysis corresponds to the full-length integrity of an mRNA sample.

We start by cleaving the 5′ end of the mRNAs, then use LCMS to determine the mass of capped and uncapped species by the following formula:

We use 40 as the extinction coefficient for our mRNAs. Assigning a sequence-specific extinction coefficient for mRNA can be problematic due to its dependence on length and sequence composition.  Factors like final buffer and temperature can also impact results.  Thus, it is standard to use 40 for all mRNA species and not to calculate a coefficient for each sequence as you would with an oligonucleotide.