Contact Us

CleanCap® Cas9 mRNA - (L-7606)

CleanCap® CRISPR Associated Protein 9 mRNA
In stock
default
L-7606
Product SKU Unit Size Price Qty
L-7606-100 100 µg
$355.00
L-7606-1000 1 mg
$1,943.00
L-7606-5 5 x 1 mg
$6,968.00

0

Description

Cas9 mRNA expresses a version of the Streptococcus pyogenes SF370 Cas9 protein (CRISPR Associated Protein 9). Cas9 functions as part of the CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) genome editing system. In the CRISPR system, an RNA guide sequence targets the site of interest and the Cas9 protein is employed to perform double stranded DNA cleavage.

Cas9 mRNA encodes the Cas9 protein with an N and C terminal nuclear localization signal (NLS). The incorporation of two NLS signals within the mRNA increases the frequency of delivery to the nucleus, thus increasing the rate of DNA cleavage. Additionally, a C terminal HA epitope tag aids detection, isolation, and purification of the Cas9 protein.

This mRNA is capped using CleanCap® Reagent AG, TriLink's patented co-transciptional capping technology, which results in the naturally occurring Cap-1 structure with >95% capping efficiency. It is manufactured using TriLink’s CleanScript™ method*, polyadenylated, and optimized for mammalian systems. It mimics a fully processed mature mRNA.

CleanCap® Reagent AG produces a base-modified Cap-1 mRNA, which shows superior in vivo activity compared to Cap-0 mRNA produced by legacy capping methods such as mCap or anti-reverse cap analog (ARCA).

CleanScript™ method is TriLink’s proprietary in vitro transcription process that is optimized to minimize dsRNA formation and increase mRNA activity in vivo.

*Starting April 30th, 2024

Product details
Catalog No L-7606
Purity Passes Agarose Gel Mobility
Length 4522 nucleotides
Base Composition Unmodified bases
Concentration 1.0 mg/mL
Buffer 1 mM Sodium Citrate pH 6.4
Conversion Factor 40 µg/OD260
Recommended Storage At or below -40°C
Application CRISPR, Immunotherapeutics, Recombinases
Cap AG Start, Cap 1, CleanCap
Other Name(s) CleanCap® CRISPR Associated Protein 9 mRNA
Technical documents

L-7606 Safety Data Sheet

L-7606 Product Insert

CleanCap Cas9 ORF Sequence

Products faqs

They all contain an optimal 5′ Cap 1 found in higher eukaryotes for their functionality and stability. They also contain a synthetic 5′ UTR with a strong Kozak sequence for efficient translation and a 3′ UTR derived from mouse alpha-globin. Their key differences lie in the type of CleanCap® analog used and the sequence compositions, which may affect their protein expression and immunogenicity.

 

CleanCap® mRNAs

CleanCap® mRNAs (5moU)

CleanCap® M6 mRNAs (N1MePsU)

Expression system

Mammalian

Mammalian

Mammalian

5′ cap

Cap 1

Cap 1

Cap 1

Cap analog

CleanCap® AG

CleanCap® AG

CleanCap® M6

5′ and 3′ UTRs

Included

Included

Included

Poly(A) tail

120 nt

120 nt

120 nt

Sequence composition

Unmodified uridines

Uridines substituted with 5-methoxyuridines

Uridines substituted with N1-methylpseudouridines

Protein expression

High

High

Highest

Immunogenicity

Normal

Reduced

Lowest

 

It is TriLink’s proprietary in vitro transcription method that produces high-quality, high-yield mRNAs from a broad range of sequences. It has been optimized to minimize dsRNA and improve in vivo protein expression from the resulting mRNAs. Please see here for more information.

Our catalog mRNAs are intended for research use and manufactured with procedures in place to minimize endotoxin exposure. However, they are manufactured outside of a cleanroom and thus are not released with an endotoxin specification.  If you need mRNA released with an endotoxin specification or a higher grade of material, please contact [email protected].

We recommend storing the mRNAs at -400 C to -800 C. To minimize freeze-thaw cycles, aliquot the sample into single-use quantities on the first usage. If kept under these conditions, our catalog mRNAs have been shown to maintain stability for at least 2 years.

The sequence reported is just the ORF, start codon to stop codon, for our catalog mRNAs. It does not include the proprietary 5′ UTR, 3′ UTR, or the 120-nt poly-A tail. For full mRNA length and the length of the ORF please see the corresponding product insert.

Our catalog mRNAs are purified through DNase treatment to remove DNA templates, diafiltration to remove salts and small molecules, and oligo dT capture to remove impurities and retain species with poly(A) tails. 

We do not carry Cy5-labeled mRNAs as catalog products. You may order them as a custom mRNA by completing this request form.

Our CleanCap® Cas9 mRNA, CleanCap® Cas9 mRNAs (5moU), and CleanCap® Cas9 mRNA (N1MePsU) contain an HA tag, 5′ TACCCCTACGACGTGCCCGACTACGCC 3′. 

We use the dot blot test, which is a qualitative test to determine the relative amount of dsRNA present in a sample. Generally, this test is performed to assess dsRNA levels in mRNAs before and after RP-HPLC purification.

We minimize the dsRNA level in our ready-to-use mRNAs by incorporating stringent processes that consist of:

  • In vitro transcription using our proprietary CleanScript™ method or the CleanCap® M6 protocol
  • Multiple post-IVT purification steps

We also assess dsRNA level in the sample by dot blot as part of quality analysis.

We look for a single main band running to approximately the correct length to pass the gel result.  Some factors such as modified NTPs can make a sample run slightly lower than the expected size.  Sometimes, sequence-related factors such as highly repetitive or UTP-rich regions (especially when modified UTP is used) can result in additional bands.  We take account of all these factors to confirm that the mRNA was manufactured appropriately and the band is sequence specific before passing the results.

The fragment analyzer reports the percent of smear with a chromatogram. The smear analysis corresponds to the full-length integrity of an mRNA sample.

We start by cleaving the 5′ end of the mRNAs, then use LCMS to determine the mass of capped and uncapped species by the following formula:

We use 40 as the extinction coefficient for our mRNAs. Assigning a sequence-specific extinction coefficient for mRNA can be problematic due to its dependence on length and sequence composition.  Factors like final buffer and temperature can also impact results.  Thus, it is standard to use 40 for all mRNA species and not to calculate a coefficient for each sequence as you would with an oligonucleotide.

Certificate of analysis

CoA search tool

Intellectual property

CRISPR/Cas9 License For research use only. Provided with a limited use license under licenses with The Broad Institute and ERS Genomics Ltd.

CleanCap capping technology For Research Use Only. Not for use in humans. Not for use in diagnostic or therapeutic purposes. For additional licensing restrictions, please see the license agreement at trilinkbiotech.com/cleancap-research-license. Patents and patent pending, see trilinkbiotech.com/legal-notices.

Products are for research use only, not for use in diagnostic or therapeutic procedures or for use in humans. Products are not for resale without express written permission from TriLink No license under any patent or other intellectual property right of TriLink or its licensors is granted or implied by the purchase unless otherwise provided in writing.

TriLink does not warrant that the use or sale of the products delivered hereunder will not infringe the claims of any United States or other patents or patents pending covering the use of the product alone or in combination with other products or in the operation of any process. All and any use of TriLink product is the purchaser's sole responsibility.

References
  1. Huang, Bonnie; Gomez-Rodriguez, Julio; Preite, Silvia; Garrett, Lisa J.; Harper, Ursula L.; Schwartzberg, Pamela L. . CRISPR-Mediated Triple Knockout of SLAMF1, SLAMF5 and SLAMF6 Supports Positive Signaling Roles in NKT Cell Development.
  2. Feng, Jifan; Jing, Junjun; Sanchez-Lara, Pedro A.; Bootwalla, Moiz S.; Buckley, Jonathan; Wu, Nancy; Yan, Youzhen; Chai, Yang . Generation and characterization of tamoxifen-inducible Pax9-CreER knock-in mice using CrispR/Cas9.
  3. Kehler, James; Greco, Marianna; Martino, Valentina; Pachiappan, Manickam; Yokoe, Hiroko; Chen, Alice; Yang, Miranda; Auerbach, Jonathan; Jessee, Joel; Gotte, Martin; Milanesi, Luciano; Albertini, Alberto; Bellipanni, Gianfranco; Zucchi, Ileana; Reinbold, Rolland A.; Giordano, Antonio . RNA-Generated and Gene-Edited Induced Pluripotent Stem Cells for Disease Modeling and Therapy.
  4. Peterson, Kevin A.; Beane, Glen L.; Goodwin, Leslie O.; Kutny, Peter M.; Reinholdt, Laura G.; Murray, Stephen A. . CRISPRtools: a flexible computational platform for performing CRISPR/Cas9 experiments in the mouse.
  5. Cunningham, Christopher L.; Wu, Zizhen; Jafari, Aria; Zhao, Bo; Schrode, Kat; Harkins-Perry, Sarah; Lauer, Amanda; Müller, Ulrich . The murine catecholamine methyltransferase mTOMT is essential for mechanotransduction by cochlear hair cells.
  6. Zhang, Xu; Chen, Xiaoli; Liu, Qiuying; Zhang, Shaojie; Hu, Wenqian . Translation repression via modulation of the cytoplasmic poly(A)-binding protein in the inflammatory response.
  7. Brophy, Patrick D.; Rasmussen, Maria; Parida, Mrutyunjaya; Bonde, Greg; Darbro, Benjamin W.; Hong, Xiaojing; Clarke, Jason C.; Peterson, Kevin A.; Denegre, James; Schneider, Michael; Sussman, Caroline R.; Sunde, Lone; Lildballe, Dorte L.; Hertz, Jens Michael; Cornell, Robert A.; Murray, Stephen A.; Manak, J. Robert . A Gene Implicated in Activation of Retinoic Acid Receptor Targets Is a Novel Renal Agenesis Gene in Humans.
  8. Kieffer-Kwon, Kyong-Rim; Nimura, Keisuke; Rao, Suhas S. P.; Xu, Jianliang; Jung, Seolkyoung; Pekowska, Aleksandra; Dose, Marei; Stevens, Evan; Mathe, Ewy; Dong, Peng; Huang, Su-Chen; Ricci, Maria Aurelia; Baranello, Laura; Zheng, Ying; Tomassoni Ardori, Francesco; Resch, Wolfgang; Stavreva, Diana; Nelson, Steevenson; McAndrew, Michael; Casellas, Adriel; Finn, Elizabeth; Gregory, Charles; St Hilaire, Brian Glenn; Johnson, Steven M.; Dubois, Wendy; Cosma, Maria Pia; Batchelor, Eric; Levens, David; Phair, Robert D.; Misteli, Tom; Tessarollo, Lino; Hager, Gordon; Lakadamyali, Melike; Liu, Zhe; Floer, Monique; Shroff, Hari; Aiden, Erez Lieberman; Casellas, Rafael . Myc Regulates Chromatin Decompaction and Nuclear Architecture during B Cell Activation.
  9. Nishino, Kimihiro; Yamamoto, Eiko; Niimi, Kaoru; Sekiya, Yoko; Yamashita, Yoriko; Kikkawa, Fumitaka . N-acetylglucosaminyltransferase IVa promotes invasion of choriocarcinoma.
  10. Kramer, Ashley C.; Blake, Amanda L.; Taisto, Mandy E.; Lehrke, Michael J.; Webber, Beau R.; Lund, Troy C. . Dermatopontin in Bone Marrow Extracellular Matrix Regulates Adherence but Is Dispensable for Murine Hematopoietic Cell Maintenance.
  11. Papizan, James B.; Garry, Glynnis A.; Brezprozvannaya, Svetlana; McAnally, John R.; Bassel-Duby, Rhonda; Liu, Ning; Olson, Eric N. . Deficiency in Kelch protein Klhl31 causes congenital myopathy in mice.
  12. Crawford, Nicholas G.; Kelly, Derek E.; Hansen, Matthew E. B.; Beltrame, Marcia H.; Fan, Shaohua; Bowman, Shanna L.; Jewett, Ethan; Ranciaro, Alessia; Thompson, Simon; Lo, Yancy; Pfeifer, Susanne P.; Jensen, Jeffrey D.; Campbell, Michael C.; Beggs, William; Hormozdiari, Farhad; Mpoloka, Sununguko Wata; Mokone, Gaonyadiwe George; Nyambo, Thomas; Meskel, Dawit Wolde; Belay, Gurja; Haut, Jake; Rothschild, Harriet; Zon, Leonard; Zhou, Yi; Kovacs, Michael A.; Xu, Mai; Zhang, Tongwu; Bishop, Kevin; Sinclair, Jason; Rivas, Cecilia; Elliot, Eugene; Choi, Jiyeon; Li, Shengchao A.; Hicks, Belynda; Burgess, Shawn; Abnet, Christian; Watkins-Chow, Dawn E.; Oceana, Elena; Song, Yun S.; Eskin, Eleazar; Brown, Kevin M.; Marks, Michael S.; Loftus, Stacie K.; Pavan, William J.; Yeager, Meredith; Chanock, Stephen; Tishkoff, Sarah A. . Loci associated with skin pigmentation identified in African populations.
  13. Schuster, Cornelia; Jonas, Franziska; Zhao, Fangzhu; Kissler, Stephan . Peripherally induced regulatory T cells contribute to the control of autoimmune diabetes in the NOD mouse model.
  14. Yin, Hao; Song, Chun-Qing; Suresh, Sneha; Wu, Qiongqiong; Walsh, Stephen; Rhym, Luke Hyunsik; Mintzer, Esther; Bolukbasi, Mehmet Fatih; Zhu, Lihua Julie; Kauffman, Kevin; Mou, Haiwei; Oberholzer, Alicia; Ding, Junmei; Kwan, Suet-Yan; Bogorad, Roman L.; Zatsepin, Timofei; Koteliansky, Victor; Wolfe, Scot A.; Xue, Wen; Langer, Robert; Anderson, Daniel G. . Structure-guided chemical modification of guide RNA enables potent non-viral in vivo genome editing.
  15. Liu, Dajiang J.; Peloso, Gina M.; Yu, Haojie; Butterworth, Adam S.; Wang, Xiao; Mahajan, Anubha; Saleheen, Danish; Emdin, Connor; Alam, Dewan; Alves, Alexessander Couto; Amouyel, Philippe; Di Angelantonio, Emanuele; Arveiler, Dominique; Assimes, Themistocles L.; Auer, Paul L.; Baber, Usman; Ballantyne, Christie M.; Bang, Lia E.; Benn, Marianne; Bis, Joshua C.; Boehnke, Michael; Boerwinkle, Eric; Bork-Jensen, Jette; Bottinger, Erwin P.; Brandslund, Ivan; Brown, Morris; Busonero, Fabio; Caulfield, Mark J.; Chambers, John C.; Chasman, Daniel I.; Chen, Y. Eugene; Chen, Yii-Der Ida; Chowdhury, Rajiv; Christensen, Cramer; Chu, Audrey Y.; Connell, John M.; Cucca, Francesco; Cupples, L. Adrienne; Damrauer, Scott M.; Davies, Gail; Deary, Ian J.; Dedoussis, George; Denny, Joshua C.; Dominiczak, Anna; Dubé, Marie-Pierre; Ebeling, Tapani; Eiriksdottir, Gudny; Esko, Tõnu; Farmaki, Aliki-Eleni; Feitosa, Mary F.; Ferrario, Marco; Ferrieres, Jean; Ford, Ian; Fornage, Myriam; Franks, Paul W.; Frayling, Timothy M.; Frikke-Schmidt, Ruth; Fritsche, Lars G.; Frossard, Philippe; Fuster, Valentin; Ganesh, Santhi K.; Gao, Wei; Garcia, Melissa E.; Gieger, Christian; Giulianini, Franco; Goodarzi, Mark O.; Grallert, Harald; Grarup, Niels; Groop, Leif; Grove, Megan L.; Gudnason, Vilmundur; Hansen, Torben; Harris, Tamara B.; Hayward, Caroline; Hirschhorn, Joel N.; Holmen, Oddgeir L.; Huffman, Jennifer; Huo, Yong; Hveem, Kristian; Jabeen, Sehrish; Jackson, Anne U.; Jakobsdottir, Johanna; Jarvelin, Marjo-Riitta; Jensen, Gorm B.; Jørgensen, Marit E.; Jukema, J. Wouter; Justesen, Johanne M.; Kamstrup, Pia R.; Kanoni, Stavroula; Karpe, Fredrik; Kee, Frank; Khera, Amit V.; Klarin, Derek; Koistinen, Heikki A.; Kooner, Jaspal S.; Kooperberg, Charles; Kuulasmaa, Kari; Kuusisto, Johanna; Laakso, Markku; Lakka, Timo; Langenberg, Claudia; Langsted, Anne; Launer, Lenore J.; Lauritzen, Torsten; Liewald, David C. M.; Lin, Li An; Linneberg, Allan; Loos, Ruth J. F.; Lu, Yingchang; Lu, Xiangfeng; Mägi, Reedik; Malarstig, Anders; Manichaikul, Ani; Manning, Alisa K.; Mäntyselkä, Pekka; Marouli, Eirini; Masca, Nicholas G. D.; Maschio, Andrea; Meigs, James B.; Melander, Olle; Metspalu, Andres; Morris, Andrew P.; Morrison, Alanna C.; Mulas, Antonella; Müller-Nurasyid, Martina; Munroe, Patricia B.; Neville, Matt J.; Nielsen, Jonas B.; Nielsen, Sune F.; Nordestgaard, Børge G.; Ordovas, Jose M.; Mehran, Roxana; O'Donnell, Christoper J.; Orho-Melander, Marju; Molony, Cliona M.; Muntendam, Pieter; Padmanabhan, Sandosh; Palmer, Colin N. A.; Pasko, Dorota; Patel, Aniruddh P.; Pedersen, Oluf; Perola, Markus; Peters, Annette; Pisinger, Charlotta; Pistis, Giorgio; Polasek, Ozren; Poulter, Neil; Psaty, Bruce M.; Rader, Daniel J.; Rasheed, Asif; Rauramaa, Rainer; Reilly, Dermot F.; Reiner, Alex P.; Renström, Frida; Rich, Stephen S.; Ridker, Paul M.; Rioux, John D.; Robertson, Neil R.; Roden, Dan M.; Rotter, Jerome I.; Rudan, Igor; Salomaa, Veikko; Samani, Nilesh J.; Sanna, Serena; Sattar, Naveed; Schmidt, Ellen M.; Scott, Robert A.; Sever, Peter; Sevilla, Raquel S.; Shaffer, Christian M.; Sim, Xueling; Sivapalaratnam, Suthesh; Small, Kerrin S.; Smith, Albert V.; Smith, Blair H.; Somayajula, Sangeetha; Southam, Lorraine; Spector, Timothy D.; Speliotes, Elizabeth K.; Starr, John M.; Stirrups, Kathleen E.; Stitziel, Nathan; Strauch, Konstantin; Stringham, Heather M.; Surendran, Praveen; Tada, Hayato; Tall, Alan R.; Tang, Hua; Tardif, Jean-Claude; Taylor, Kent D.; Trompet, Stella; Tsao, Philip S.; Tuomilehto, Jaakko; Tybjaerg-Hansen, Anne; van Zuydam, Natalie R.; Varbo, Anette; Varga, Tibor V.; Virtamo, Jarmo; Waldenberger, Melanie; Wang, Nan; Wareham, Nick J.; Warren, Helen R.; Weeke, Peter E.; Weinstock, Joshua; Wessel, Jennifer; Wilson, James G.; Wilson, Peter W. F.; Xu, Ming; Yaghootkar, Hanieh; Young, Robin; Zeggini, Eleftheria; Zhang, He; Zheng, Neil S.; Zhang, Weihua; Zhang, Yan; Zhou, Wei; Zhou, Yanhua; Zoledziewska, Magdalena; Howson, Joanna M. M.; Danesh, John; McCarthy, Mark I.; Cowan, Chad A.; Abecasis, Goncalo; Deloukas, Panos; Musunuru, Kiran; Willer, Cristen J.; Kathiresan, Sekar . Exome-wide association study of plasma lipids in >300,000 individuals.
  16. Markossian, Suzy; Guyot, Romain; Richard, Sabine; Teixeira, Marie; Aguilera, Nadine; Bouchet, Mathilde; Plateroti, Michelina; Guan, Wenyue; Gauthier, Karine; Aubert, Denise; Flamant, Frédéric . CRISPR/Cas9 Editing of the Mouse Thra Gene Produces Models with Variable Resistance to Thyroid Hormone.
  17. Johnson, Kenneth R.; Gagnon, Leona H.; Tian, Cong; Longo-Guess, Chantal M.; Low, Benjamin E.; Wiles, Michael V.; Kiernan, Amy E. . Deletion of a Long-Range Dlx5 Enhancer Disrupts Inner Ear Development in Mice.
  18. O'Brien, Lori L.; Guo, Qiuyu; Bahrami-Samani, Emad; Park, Joo-Seop; Hasso, Sean M.; Lee, Young-Jin; Fang, Alan; Kim, Albert D.; Guo, Jinjin; Hong, Trudy M.; Peterson, Kevin A.; Lozanoff, Scott; Raviram, Ramya; Ren, Bing; Fogelgren, Ben; Smith, Andrew D.; Valouev, Anton; McMahon, Andrew P. . Transcriptional regulatory control of mammalian nephron progenitors revealed by multi-factor cistromic analysis and genetic studies.
  19. Webber, Beau R.; O'Connor, Kyle T.; McElmurry, Ron T.; Durgin, Elise N.; Eide, Cindy R.; Lees, Christopher J.; Riddle, Megan J.; Mathews, Wendy E.; Frank, Natasha Y.; Kluth, Mark A.; Ganss, Christoph; Moriarity, Branden S.; Frank, Markus H.; Osborn, Mark J.; Tolar, Jakub . Rapid generation of Col7a1(-/-) mouse model of recessive dystrophic epidermolysis bullosa and partial rescue via immunosuppressive dermal mesenchymal stem cells.
  20. Tröder, Simon E.; Ebert, Lena K.; Butt, Linus; Assenmacher, Sonja; Schermer, Bernhard; Zevnik, Branko . An optimized electroporation approach for efficient CRISPR/Cas9 genome editing in murine zygotes.
  21. Redel, Bethany K.; Beaton, Benjamin P.; Spate, Lee D.; Benne, Joshua A.; Murphy, Stephanie L.; O'Gorman, Chad W.; Spate, Anna M.; Prather, Randall S.; Wells, Kevin D. . Single step production of Cas9 mRNA for zygote injection.
  22. Usman, Waqas Muhammad; Pham, Tin Chanh; Kwok, Yuk Yan; Vu, Luyen Tien; Ma, Victor; Peng, Boya; Chan, Yuen San; Wei, Likun; Chin, Siew Mei; Azad, Ajijur; He, Alex Bai-Liang; Leung, Anskar Y. H.; Yang, Mengsu; Shyh-Chang, Ng; Cho, William C.; Shi, Jiahai; Le, Minh T. N. . Efficient RNA drug delivery using red blood cell extracellular vesicles.
  23. Marcus, Assaf; Mao, Amy J.; Lensink-Vasan, Monisha; Wang, LeeAnn; Vance, Russell E.; Raulet, David H. . Tumor-Derived cGAMP Triggers a STING-Mediated Interferon Response in Non-tumor Cells to Activate the NK Cell Response.
  24. Kumon, T;Ma, J;Akins, RB;Stefanik, D;Nordgren, CE;Kim, J;Levine, MT;Lampson, MA; . Parallel pathways for recruiting effector proteins determine centromere drive and suppression
  25. Ostedgaard, LS;Price, MP;Whitworth, KM;Abou Alaiwa, MH;Fischer, AJ;Warrier, A;Samuel, M;Spate, LD;Allen, PD;Hilkin, BM;Romano Ibarra, GS;Ortiz Bezara, ME;Goodell, BJ;Mather, SE;Powers, LS;Stroik, MR;Gansemer, ND;Hippee, CE;Zarei, K;Goeken, JA;Businga, TR;Hoffman, EA;Meyerholz, DK;Prather, RS;Stoltz, DA;Welsh, MJ; . Lack of airway submucosal glands impairs respiratory host defenses
  26. Arroyo Hornero, R;Georgiadis, C;Hua, P;Trzupek, D;He, LZ;Qasim, W;Todd, JA;Ferreira, RC;Wood, KJ;Issa, F;Hester, J; . CD70 expression determines the therapeutic efficacy of expanded human regulatory T cells
  27. Ruthig, VA;Yokonishi, T;Friedersdorf, MB;Batchvarova, S;Hardy, J;Garness, JA;Keene, JD;Capel, B; . A transgenic DND1GFP fusion allele reports in vivo expression and RNA binding targets in undifferentiated mouse germ cells
  28. Kumon, T;Ma, J;Stefanik, D;Nordgren, E;Akins, R;Kim, J;Levine, M;Lampson, M; . Centromere drive and suppression by parallel pathways for recruiting microtubule destabilizers
  29. Brandenburger, I; . The role of metabolite receptors in tumor progression
  30. Pares Casellas, M; . Preclinical assessment of a gene editing approach for MNGIE
  31. Szpak, M;Collins, SC;Li, Y;Liu, X;Ayub, Q;Fischer, MC;Vancollie, VE;Lelliott, CJ;Xue, Y;Yalcin, B;Yang, H;Tyler-Smith, C; . A positively-selected MAGEE2 LoF allele is associated with sexual dimorphism in human brain size, and shows similar phenotypes in Magee2 null mice
  32. Sturmlechner, I;Zhang, C;Sine, CC;van Deursen, EJ;Jeganathan, KB;Hamada, N;Grasic, J;Friedman, D;Stutchman, JT;Can, I;Hamada, M;Lim, DY;Lee, JH;Ordog, T;Laberge, RM;Shapiro, V;Baker, DJ;Li, H;van Deursen, JM; . p21 produces a bioactive secretome that places stressed cells under immunosurveillance
  33. Ponia, SS;Robertson, SJ;McNally, KL;Subramanian, G;Sturdevant, GL;Lewis, M;Jessop, F;Kendall, C;Gallegos, D;Hay, A;Schwartz, C;Rosenke, R;Saturday, G;Bosio, CM;Martens, C;Best, SM; . Mitophagy antagonism by ZIKV reveals Ajuba as a regulator of PINK1 signaling, PKR-dependent inflammation, and viral invasion of tissues
  34. Yan, Y;Krecke, KN;Bapat, AS;Yang, T;Lopresti, MW;Mashek, DG;Kelekar, A; . Phosphatase PHLPP2 regulates the cellular response to metabolic stress through AMPK
  35. Nayyab, S;Gervasi, MG;Tourzani, DA;Caraballo, DA;Jha, KN;Teves, ME;Cui, W;Georg, GI;Visconti, PE;Salicioni, AM; . TSSK3, a novel target for male contraception, is required for spermiogenesis
  36. Li, S;Qian, N;Jiang, C;Zu, W;Liang, A;Li, M;Elledge, SJ;Tan, X; . Gain-of-function genetic screening identifies the antiviral function of TMEM120A via STING activation
  37. Aviles, E;Krol, A;Henle, S;Burroughs-Garcia, J;Deans, M;Goodrich, L; . Fat3 Acts Through Independent Cytoskeletal Effectors to Coordinate Asymmetric Cell Behaviors During Polarized Circuit Assembly
  38. Gabriel, GC;Devine, W;Redel, BK;Whitworth, KM;Samuel, M;Spate, LD;Cecil, RF;Prather, RS;Wu, Y;Wells, KD;Lo, CW; . Cardiovascular Development and Congenital Heart Disease Modeling in the Pig
  39. Tamada, K;Fukumoto, K;Toya, T;Nakai, N;Awasthi, JR;Tanaka, S;Okabe, S;Spitz, F;Saitow, F;Suzuki, H;Takumi, T; . Genetic dissection identifies Necdin as a driver gene in a mouse model of paternal 15q duplications
  40. Chambers, I;Kumar, P;Lichtenberg, J;Wang, P;Yu, J;Phillips, J;Kane, M;Bodine, D;Hamza, I; . MRP5 and MRP9 Play a Concerted Role in Male Reproduction and Mitochondrial Function
  41. Polla, DL;Edmondson, AC;Duvet, S;March, ME;Sousa, AB;Lehman, A;CAUSES Study, ;Niyazov, D;van Dijk, F;Demirdas, S;van Slegtenhorst, MA;Kievit, AJA;Schulz, C;Armstrong, L;Bi, X;Rader, DJ;Izumi, K;Zackai, EH;de Franco, E;Jorge, P;Huffels, SC;Hommersom, M;Ellard, S;Lefeber, DJ;Santani, A;Hand, NJ;van Bokhoven, H;He, M;de Brouwer, APM; . Bi-allelic variants in the ER quality control mannosidase gene EDEM3 cause a congenital disorder of glycosylation
Show more