My Account | Shopping Cart | Contact
Trilink Biotech Logo

Oligonucleotides | Nucleotides | Custom Chemistry | CleanTag™ | CleanAmp™ |mRNA & Long RNA | GMP
RNA Transcripts
mRNA & Long RNA

Custom Services
mRNA Synthesis

Long RNA Synthesis
Request A Quote

Stocked mRNA
Reporter Gene
Genome Editing
Gene Replacement
Reprogramming
Dye-labeled
Antigen

Tech Info
Posters
Brochure
Technical Articles
FAQs

Testimonials
Data Gallery

 

 

 

 

Genome Editing mRNA

Plasmids and viral vectors have traditionally been used in genome editing to express the required proteins inside cells or an organism. However, editing DNA carries a risk. Double stranded DNA breaks catalyze insertion of DNA at the cut site. At some substantial frequency, the protein expression vectors can integrate, which can lead to continuous expression of the nuclease or a previously silent sequence.

Now mRNA is being used in genome editing to transiently express the required proteins. With no risk of insertional mutagenesis, it is a powerful tool. Additionally synthetic mRNA, which mimics fully processed, capped and polyadenylated mRNA, can be produced in large quantities by in vitro transcription and modified to reduce innate immune stimulation.

Products

Zinc-finger Nuclease mRNA

TALEN mRNA

Cas9 mRNA

Recombinase mRNA

Don't see what you need? Request a quote for a custom synthesis.

 

Zinc-finger Nuclease mRNA (ZFN mRNA)

Zinc-finger nucleases (ZFNs) were the first widely applicable site specific genome editing tools. Recently, several studies have shown that ZFNs can have off-target effects at non-targeted chromosomal sites that are similar in sequence to the intended target site. For this reason, there is a move to transient ZFN expression using mRNA based vectors. TriLink’s custom mRNA transcription service includes ZFN mRNA. Request a quote today!

Order

Zinc fingers are the most common DNA binding motif in mammalian transcription factors. These sequence specific binding domains can be engineered to bind to novel DNA sequences. Zinc fingers can be turned into nucleases by fusing them to non-specific cleavage domains, such as the FokI nuclease. FokI cleaves as a dimer, so pairs of ZFNs are designed to bind to adjacent sites in the genome to allow FokI dimer formation and double stranded DNA cleavage. A number of laboratories have published design rules that serve as a starting point to engineer ZFNs with novel DNA binding specificities (See ZFN Design Rules References). However, actual binding specificity is context dependent.

Several selection protocols in cells also exist for identifying novel ZFNs. ZFNs have been successfully used to modify the genomes of Drosophila, C. elegans, zebrafish and rats (See ZFN Organism Modification References). However, identification of functional ZFNs remains challenging and most have emerged from a small number of laboratories with specialist skills and from a company called Sangamo Biosciences.

ZFN

 

Transcription Activator-like Effector Nuclease mRNA (TALEN mRNA)

In the last few years, TALENs have emerged as a more accessible alternative to zinc-finger nucleases (ZFN). Like ZFNs, TALENs utilize a modular DNA binding motif that can be modified to introduce new DNA binding specificities. Unlike ZFNs, TALENs are not as prone to sequence context effects which greatly complicate the de novo design, making them a more practical tool for the general scientific community. TriLink’s custom mRNA transcription service includes TALEN mRNA. Request a quote today!

Order

A TALEN consists of multiple repeat variable di-residues (RVDs) which each specify binding to a single nucleotide (See TALEN References). TALEN arrays are made by stringing together RVDs in a specific order to provide specificity and binding affinity to novel DNA sequences. Commonly, engineered TALE sequences are fused to non-specific cleavage domains such as FokI. As with ZFNs, TALENs function as pairs bound to adjacent DNA sequences. TriLink offers mRNA expression vectors that are designed to easily accept a TALEN cloned using the Golden Gate method (See Golden Gate References).

TALEN

 

Cas9 mRNA

The newest tool in the genome editing arena was adapted from a bacterial immune system, clustered regularly interspaced short palindromic repeats (CRISPR). CRISPR enables bacteria to sample pathogen DNA, integrate foreign DNA into their genome in specialized repeat structures and use these sequences to produce guide RNA. The guide RNA directs cutting of homologous pathogenic DNA sequences. To some degree this is reminiscent of RNA interference in mammals. Once the target site has been delineated by the RNA guide sequence, CRISPR-associated (Cas) proteins do the cutting.

TriLink offers both wild-type Cas9 mRNA , which creates a double stranded break at the target site, and Cas9 Nickase mRNA , which creates a single stranded break. This favors homology-directed repair and decreases the occurrence of non-homologous end joining.

Order

 

Recombinase mRNA

Site specific recombinases are useful tools for manipulation of genomes and for conditionally activating or de-activating gene expression in cells and organisms. Recombinases recognize short target DNA sequences of approximately 30-40 nucleotides and catalyze directional DNA exchange reactions. These exchange reactions fall into four categories: excisions/insertions, inversions, translocations and cassette exchanges. Because the recognition sites are not commonly found in the genomes of higher organisms, they can be used as tools to engineer genomes. However, continued expression of a recombinase in a cell or in vivo can result in toxicity and undesired off-target recombination. For this reason, transient expression from mRNA is an ideal method for recombinase expression.

Recombinase Activity

CleanCap™ NLS-Cre Recombinase mRNA (5moU)

Our CleanCap™ NLS-Cre Recombinase mRNA is a capped (Cap 1) and polyadenylated messenger RNA encoding Cre recombinase fused to a nuclear localization sequence (NLS). Cre recombinase is a tyrosine recombinase derived from the P1 bacteriophage. Cre catalyzes recombination between two loxP sites which consist of a 34 base pair recognition site (5' ATAACTTCGTATAGCATACATTATACGAAGTTAT 3').

Order

Cre recombinase has been used extensively to manipulate DNA in plants, bacteria, yeast and mammals. Depending on the orientation of the loxP sites, Cre can be used to induce DNA cassette exchanges, excisions/insertions, inversions and translocations. If the genetic element is floxed by two loxP elements both in the forward orientation, treatment with Cre recombinase causes the deletion of the intervening genetic element. Expression of Cre can cause activation or inactivation of that genetic element.

Applications for NLS-Cre Recombinase mRNA include creation of knock-out or knock-in animals, tissue specific protein expression and marking studies that report delivery of mRNA to a given cell type. Cre recombinase mRNA is also a useful tool in assessing the efficacy of mRNA delivery in vitro and in vivo.

Reference(s)

ZFN (Design Rules)
Segal DJ, Dreier B, Beerli RR, Barbas CF 3rd. Toward controlling gene expression at will: selection and design of zinc finger domains recognizing each of the 5'-GNN-3' DNA target sequences. Proc Natl Acad Sci U S A. 1999 Mar 16;96(6):2758-63.

Dreier B, Segal DJ, Barbas CF 3rd. Insights into the molecular recognition of the 5'-GNN-3' family of DNA sequences by zinc finger domains. J Mol Biol. 2000 Nov 3;303(4):489-502.

Liu Q, Xia Z, Zhong X, Case CC. Validated zinc finger protein designs for all 16 GNN DNA triplet targets. J Biol Chem. 2002 Feb 8;277(6):3850-6

Dreier B, Beerli RR, Segal DJ, Flippin JD, Barbas CF 3rd. Development of zinc finger domains for recognition of the 5'-ANN-3' family of DNA sequences and their use in the construction of artificial transcription factors. J Biol Chem. 2001 Aug 3;276(31):29466-78.

Dreier B, Fuller RP, Segal DJ, Lund CV, Blancafort P, Huber A, Koksch B, Barbas CF 3rd. Development of zinc finger domains for recognition of the 5'-CNN-3' family DNA sequences and their use in the construction of artificial transcription factors. J Biol Chem. 2005 Oct 21;280(42):35588-97.

ZFN (Organism Modification)
Beumer KJ, Trautman JK, Bozas A, Liu JL, Rutter J, Gall JG, Carroll D. Efficient gene targeting in Drosophila by direct embryo injection with zinc-finger nucleases. Proc Natl Acad Sci U S A. 2008 Dec 16;105(50):19821-6.

Beumer KJ, Trautman JK, Bozas A, Liu JL, Rutter J, Gall JG, Carroll D. Efficient gene targeting in Drosophila by direct embryo injection with zinc-finger nucleases. Proc Natl Acad Sci U S A. 2008 Dec 16;105(50):19821-6.

Bibikova M, Golic M, Golic KG, Carroll D. Targeted chromosomal cleavage and mutagenesis in Drosophila using zinc-finger nucleases. Genetics. 2002 Jul;161(3):1169-75.

Bozas A, Beumer KJ, Trautman JK, Carroll D. Genetic analysis of zinc-finger nuclease-induced gene targeting in Drosophila. Genetics. 2009 Jul;182(3):641-51.

Morton J, Davis MW, Jorgensen EM, Carroll D. Induction and repair of zinc-finger nuclease-targeted double-strand breaks in Caenorhabditis elegans somatic cells. Proc Natl Acad Sci U S A. 2006 Oct 31;103(44):16370-5.

Doyon Y, McCammon JM, Miller JC, Faraji F, Ngo C, Katibah GE, Amora R, Hocking TD, Zhang L, Rebar EJ, Gregory PD, Urnov FD, Amacher SL. Heritable targeted gene disruption in zebrafish using designed zinc-finger nucleases. Nat Biotechnol. 2008 Jun;26(6):702-8.

Ekker SC. Zinc finger-based knockout punches for zebrafish genes. Zebrafish. 2008 Summer;5(2):121-3.

Foley JE, Yeh JR, Maeder ML, Reyon D, Sander JD, Peterson RT, Joung JK. Rapid mutation of endogenous zebrafish genes using zinc finger nucleases made by Oligomerized Pool ENgineering (OPEN). PLoS One. 2009;4(2):e4348.

Meng X, Noyes MB, Zhu LJ, Lawson ND, Wolfe SA. Targeted gene inactivation in zebrafish using engineered zinc-finger nucleases. Nat Biotechnol. 2008 Jun;26(6):695-701.

Geurts AM, et. al. Knockout rats via embryo microinjection of zinc-finger nucleases. Science. 2009 Jul 24;325(5939):433.

TALENS
Boch J, Scholze H, Schornack S, Landgraf A, Hahn S, Kay S, Lahaye T, Nickstadt A, Bonas U. Breaking the code of DNA binding specificity of TAL-type III effectors. Science. 2009 Dec 11;326(5959):1509-12.

Mak AN, Bradley P, Cernadas RA, Bogdanove AJ, Stoddard BL. The crystal structure of TAL effector PthXo1 bound to its DNA target. Science. 2012 Feb 10;335(6069):716-9.

Moscou MJ, Bogdanove AJ. A simple cipher governs DNA recognition by TAL effectors. Science. 2009 Dec 11;326(5959):1501.

Golden Gate
Cermak T, Doyle EL, Christian M, Wang L, Zhang Y, Schmidt C, Baller JA, Somia NV, Bogdanove AJ, Voytas DF. Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. Nucleic Acids Res. 2011 Jul;39(12):e82.

Li T, Huang S, Zhao X, Wright DA, Carpenter S, Spalding MH, Weeks DP, Yang B. Modularly assembled designer TAL effector nucleases for targeted gene knockout and gene replacement in eukaryotes. Nucleic Acids Res. 2011 Aug;39(14):6315-25.

Weber E, Engler C, Gruetzner R, Werner S, Marillonnet S. A modular cloning system for standardized assembly of multigene constructs. PLoS One. 2011 Feb 18;6(2):e16765.

Zhang F, Cong L, Lodato S, Kosuri S, Church GM, Arlotta P. Efficient construction of sequence-specific TAL effectors for modulating mammalian transcription. Nat Biotechnol. 2011 Feb;29(2):149-53.

 

Not for resale without express written permission. Not for use in humans. No license under any patent or patent pending is granted or implied by the purchase of any TriLink product. TriLink does not warrant that the use or sale of the products delivered hereunder will not infringe the claims of any United States or other patents or patents pending covering the use of the product alone or in combination with other products or in the operation of any process. All and any use of TriLink product is the purchaser?s sole responsibility.

  Twitter Twitter Facebook Facebook Linked In Linked In RSS RSS Google RSS  
© 2017 TriLink BioTechnologies, LLC | All Rights Reserved