CleanCap® M6 Cas9 mRNA (N1MePsU) - (L-8106)
Cas9 mRNA expresses a version of the Streptococcus pyogenes SF370 Cas9 protein (CRISPR Associated Protein 9). Cas9 functions as part of the CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) genome editing system. In the CRISPR system, an RNA guide sequence targets the site of interest and the Cas9 protein is employed to perform double-stranded DNA cleavage.
Cas9 mRNA encodes the Cas9 protein with an N and C terminal nuclear localization signal (NLS). The incorporation of two NLS signals within the mRNA increases the frequency of delivery to the nucleus, thus increasing the rate of DNA cleavage. Additionally, a C terminal HA epitope tag aids in detection, isolation, and purification of the Cas9 protein.
This mRNA is capped using CleanCap® Reagent M6, TriLink’s patented co-transcriptional capping technology, resulting in the naturally occurring Cap-1 structure with >95% capping efficiency. It is polyadenylated, modified with N1-methylpseudouridine, and optimized for mammalian systems. It mimics a fully processed mature mRNA.
CleanCap Reagent M6, otherwise known as CleanCap m6AG 3′ OMe, produces a base-modified Cap-1 mRNA, which shows superior in vivo activity compared to Cap-0 mRNA produced by legacy capping methods such as mCap or anti-reverse cap analog (ARCA). CleanCap M6 may further increase protein expression relative to previous generations of cap analogs, such as CleanCap AG or CleanCap AG (3′ OMe), or mRNAs produced by enzymatic capping strategies.
N1-methylpseudouridine is a modified uridine that can reduce immunogenic response and enhance translational efficiency of mRNAs. These properties can result in safer mRNA and increased protein expression.
Catalog No | L-8106 |
---|---|
Purity | Passes Agarose Gel Mobility |
Length | 4522 nucleotides |
Base Composition | Fully substituted with N1-Methyl-Pseudo-U |
Concentration | 1.0 mg/mL |
Buffer | 1 mM Sodium Citrate pH 6.4 |
Conversion Factor | 40 µg/OD260 |
Recommended Storage | At or below -40°C |
Application | CRISPR, Immunotherapeutics, Recombinases |
Cap | AG Start, Cap 1, CleanCap, CleanCap Reagent M6, CleanCap m6AG 3'OMe |
Other Name(s) | CleanCap® M6 CRISPR Associated Protein 9 mRNA (N1-methylpseudouridine) |
They all contain an optimal 5′ Cap 1 found in higher eukaryotes for their functionality and stability. They also contain a synthetic 5′ UTR with a strong Kozak sequence for efficient translation and a 3′ UTR derived from mouse alpha-globin. Their key differences lie in the type of CleanCap® analog used and the sequence compositions, which may affect their protein expression and immunogenicity.
|
|||
Expression system |
Mammalian |
Mammalian |
Mammalian |
5′ cap |
Cap 1 |
Cap 1 |
Cap 1 |
Cap analog |
|||
5′ and 3′ UTRs |
Included |
Included |
Included |
Poly(A) tail |
120 nt |
120 nt |
120 nt |
Sequence composition |
Uridines substituted with 5-methoxyuridines |
Uridines substituted with N1-methylpseudouridines |
|
Protein expression |
High |
High |
Highest |
Immunogenicity |
Normal |
Reduced |
Lowest |
It is TriLink’s proprietary in vitro transcription method that produces high-quality, high-yield mRNAs from a broad range of sequences. It has been optimized to minimize dsRNA and improve in vivo protein expression from the resulting mRNAs. Please see here for more information.
Our catalog mRNAs are intended for research use and manufactured with procedures in place to minimize endotoxin exposure. However, they are manufactured outside of a cleanroom and thus are not released with an endotoxin specification. If you need mRNA released with an endotoxin specification or a higher grade of material, please contact [email protected].
We recommend storing the mRNAs at -400 C to -800 C. To minimize freeze-thaw cycles, aliquot the sample into single-use quantities on the first usage. If kept under these conditions, our catalog mRNAs have been shown to maintain stability for at least 2 years.
The sequence reported is just the ORF, start codon to stop codon, for our catalog mRNAs. It does not include the proprietary 5′ UTR, 3′ UTR, or the 120-nt poly-A tail. For full mRNA length and the length of the ORF please see the corresponding product insert.
Our catalog mRNAs are purified through DNase treatment to remove DNA templates, diafiltration to remove salts and small molecules, and oligo dT capture to remove impurities and retain species with poly(A) tails.
We do not carry Cy5-labeled mRNAs as catalog products. You may order them as a custom mRNA by completing this request form.
Our CleanCap® Cas9 mRNA, CleanCap® Cas9 mRNAs (5moU), and CleanCap® Cas9 mRNA (N1MePsU) contain an HA tag, 5′ TACCCCTACGACGTGCCCGACTACGCC 3′.
We use the dot blot test, which is a qualitative test to determine the relative amount of dsRNA present in a sample. Generally, this test is performed to assess dsRNA levels in mRNAs before and after RP-HPLC purification.
We minimize the dsRNA level in our ready-to-use mRNAs by incorporating stringent processes that consist of:
- In vitro transcription using our proprietary CleanScript™ method or the CleanCap® M6 protocol
- Multiple post-IVT purification steps
We also assess dsRNA level in the sample by dot blot as part of quality analysis.
We look for a single main band running to approximately the correct length to pass the gel result. Some factors such as modified NTPs can make a sample run slightly lower than the expected size. Sometimes, sequence-related factors such as highly repetitive or UTP-rich regions (especially when modified UTP is used) can result in additional bands. We take account of all these factors to confirm that the mRNA was manufactured appropriately and the band is sequence specific before passing the results.
The fragment analyzer reports the percent of smear with a chromatogram. The smear analysis corresponds to the full-length integrity of an mRNA sample.
We start by cleaving the 5′ end of the mRNAs, then use LCMS to determine the mass of capped and uncapped species by the following formula:
We use 40 as the extinction coefficient for our mRNAs. Assigning a sequence-specific extinction coefficient for mRNA can be problematic due to its dependence on length and sequence composition. Factors like final buffer and temperature can also impact results. Thus, it is standard to use 40 for all mRNA species and not to calculate a coefficient for each sequence as you would with an oligonucleotide.
CRISPR/Cas9 License For research use only. Provided with a limited use license under licenses with The Broad Institute and ERS Genomics Ltd.
CleanCap capping technology For Research Use Only. Not for use in humans. Not for use in diagnostic or therapeutic purposes. For additional licensing restrictions, please see the license agreement at trilinkbiotech.com/cleancap-research-license. Patents and patent pending, see trilinkbiotech.com/legal-notices.
Products are for research use only, not for use in diagnostic or therapeutic procedures or for use in humans. Products are not for resale without express written permission from TriLink No license under any patent or other intellectual property right of TriLink or its licensors is granted or implied by the purchase unless otherwise provided in writing.
TriLink does not warrant that the use or sale of the products delivered hereunder will not infringe the claims of any United States or other patents or patents pending covering the use of the product alone or in combination with other products or in the operation of any process. All and any use of TriLink product is the purchaser's sole responsibility.